In this study, we investigated whether PenArg, originally developed as a delivery carrier, could exert intrinsic neuroprotective effects in a genetic model of PD characterized by mitochondrial dysfunction. We demonstrate that intranasal PenArg confers neuroprotection in UQCRC1 mutation–associated PD. PenArg improved mitochondrial membrane potential and reduced apoptosis in UQCRC1‐mutant SH‐SY5Y cells, indicating a direct cytoprotective effect at the cellular level. Importantly, long‐term intranasal administration of PenArg ameliorated locomotor deficits and preserved dopaminergic neuron integrity in the SN and ST, as well as hippocampal structure, in mutant mice. Collectively, these findings support PenArg as a bioactive neuroprotective agent rather than merely a delivery vector [11, 20].

Eight‐month‐old mice were randomized into four groups: WT, UQCRC1 mutant (UQ), UQCRC1 mutant receiving vehicle treatment (UQ‐Sham), and UQCRC1 mutant treated with PenArg (UQ‐PA) (n = 6 per group).

For intranasal administration, awake mice received PBS containing DMSO as vehicle control or biotinylated PenArg (0.5 mM) in a total volume of 20 μL (10 μL per nostril) using QSP 20 μL filter tips (Thermo Fisher Scientific, Waltham, MA, USA), as previously described [18]. Intranasal administration was performed three times per week for six months.

Intranasal administration significantly improved locomotor performance, preserved dopaminergic neurons in the substantia nigra (SN) and striatum, and maintained hippocampal neuronal structure. Brain distribution analysis confirmed widespread brain penetration after intranasal administration. PenArg restored ATP synthase subunit beta expression and complex III activity while reducing cytochrome c release and caspase‐3 activation in SN neurons. Treatment additionally attenuated skeletal muscle atrophy, enhanced antioxidant responses, and reduced circulating pro‐inflammatory cytokines.

Although promising, several limitations remain. PenArg showed only partial mitochondrial colocalization, and its intracellular trafficking, pharmacokinetics, and long‐term safety after intranasal delivery require further evaluation. In the present study, brain distribution was assessed only at a single time point, 2 h after intranasal administration; therefore, brain‐to‐plasma ratio, absolute nasal‐to‐brain transfer efficiency, and elimination kinetics were not determined.

Eight‐month‐old mice were randomized into four groups: WT, UQCRC1 mutant (UQ), UQCRC1 mutant receiving vehicle treatment (UQ‐Sham), and UQCRC1 mutant treated with PenArg (UQ‐PA) (n = 6 per group). Animals were housed under standard conditions with ad libitum access to food and water.

All animal procedures were conducted in accordance with AAALAC guidelines and approved by the Animal Experiments and Ethics Committee of Changhua Christian Hospital. UQCRC1 p.Y314S knock‐in mice were generated by CRISPR/Cas9 genome editing and obtained from Dr. Chin‐Hsien Lin [1]. Mice were backcrossed with C57BL/6J mice (BioLASCO, Taipei, Taiwan) for ≥ 3 generations. Genotyping was performed by PCR using primers VF1 (5′‐CCACGTGGCCATTGCAGTAGA‐3′) and VR1 (5′‐TCGATACTCATGGCATCACAGAC‐3′), followed by BsrGI digestion, as previously described [1]. Heterozygous mice were used for experiments, with WT littermates as controls. Both male and female mice were included, with sex balanced across groups where possible. Eight‐month‐old mice were randomized into four groups: WT, UQCRC1 mutant (UQ), UQCRC1 mutant receiving vehicle treatment (UQ‐Sham), and UQCRC1 mutant treated with PenArg (UQ‐PA) (n = 6 per group). Animals were housed under standard conditions with ad libitum access to food and water.

Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by the selective loss of dopaminergic neurons in the substantia nigra (SN), frequently associated with mitochondrial dysfunction, a central driver of disease progression. UQCRC1, a nuclear‐encoded subunit of mitochondrial complex III, is essential for oxidative phosphorylation. A missense mutation in UQCRC1 (p.Tyr314Ser, p.Y314S) has been identified in familial PD, leading to impaired complex III activity, oxidative stress, and neuroinflammation [1]. UQCRC1‐mutant models replicate these pathological features and provide a valuable platform for evaluating mitochondria‐targeted therapeutic strategies [1, 2].

Cell‐penetrating peptides (CPPs) are short amino acid sequences capable of traversing cellular membranes and the BBB, making them promising candidates for neurological therapy [6, 7, 8]. Beyond serving as delivery vectors9, arginine‐rich CPPs such as Arg‐9 (R9) and penetratin exhibit intrinsic cytoprotective effects independent of cargo conjugation [7, 9, 10], including preservation of mitochondrial membrane potential, attenuation of oxidative stress, and suppression of apoptotic signaling [11, 12, 13]. Whether these intrinsic properties translate into disease‐modifying effects in genetic models of mitochondrial dysfunction remains unclear.

A penetratin analog enriched with arginine residues (PenArg) was designed to enhance cellular uptake through strengthened electrostatic interactions with negatively charged membranes [14]. Given its high cationic charge density and potential interaction with mitochondrial membranes [15, 16, 17], PenArg may exert biological effects beyond cargo delivery [11]. However, its therapeutic relevance in mitochondrial‐related neurodegeneration has not been defined.

PenArg showed widespread brain distribution, consistent with olfactory and trigeminal nose‐to‐brain transport pathways that partially bypass the BBB [30, 31, 32], although precise mechanisms were not directly examined.

Human SH‐SY5Y neuroblastoma cells (ATCC, CRL‐2266, Manassas, VA, USA), including wild‐type (WT) and UQCRC1 knock‐in lines, were maintained and used in an undifferentiated state throughout the in vitro experiments. Cells were cultured in DMEM/F12 medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin–streptomycin (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) at 37°C with 5% CO2.

TMRE analysis demonstrated reduced baseline MMP in mutant cells compared with WT controls. Low‐dose PenArg (1 μM) increased TMRE intensity, whereas higher concentrations attenuated this effect (Figure 1B). Subsequent experiments therefore focused on 0.5–1 μM. At 0.5 μM, PenArg enhanced filopodia formation (Figure 1C). Although UQCRC1‐mutant cells showed reduced TMRE intensity and impaired filopodia formation under basal conditions, the percentage of 7‐AAD‐positive cells was not significantly increased compared with WT cells. Under oxidative stress challenge, PenArg reduced apoptosis, as indicated by decreased 7‐AAD positivity (Figure 1D), and preserved MMP under t‐BH exposure (Figure 1E). Overall, 0.5 μM PenArg most effectively preserved mitochondrial integrity and reduced stress‐induced apoptosis.

The UQCRC1‐mutant SH‐SY5Y cells showed reduced mitochondrial membrane potential and impaired filopodia formation, indicating mitochondrial dysfunction and cellular vulnerability. However, the percentage of 7‐AAD‐positive cells was not significantly increased compared with WT cells under basal conditions. This finding is consistent with an early or sublethal mitochondrial dysfunction phenotype induced by UQCRC1 mutation, rather than overt basal cytotoxicity, because 7‐AAD positivity mainly reflects loss of plasma membrane integrity and late‐stage cell death. Under oxidative stress challenge, PenArg reduced 7‐AAD positivity and preserved mitochondrial membrane potential, supporting its protective effect against stress‐induced cell death.

Heterozygous mice were used for experiments, with WT littermates as controls. Both male and female mice were included, with sex balanced across groups where possible. Eight‐month‐old mice were randomized into four groups: WT, UQCRC1 mutant (UQ), UQCRC1 mutant receiving vehicle treatment (UQ‐Sham), and UQCRC1 mutant treated with PenArg (UQ‐PA) (n = 6 per group).

For intranasal administration, awake mice received PBS containing DMSO as vehicle control or biotinylated PenArg (0.5 mM) in a total volume of 20 μL (10 μL per nostril) using QSP 20 μL filter tips (Thermo Fisher Scientific, Waltham, MA, USA), as previously described [18]. Intranasal administration was performed three times per week for six months.

In addition, a positive control treatment was not included, which limits direct comparison of PenArg efficacy with established mitochondrial protective or neuroprotective agents. Representative olfactory bulb streptavidin‐biotin staining showed no overt structural disruption after three months of chronic intranasal PenArg treatment (Figure S1). However, further nasal histology and systemic toxicity studies are needed to confirm the safety of repeated intranasal PenArg administration. The potential immunogenicity of arginine‐rich CPPs in humans also warrants investigation.

Compared with WT littermate mice, UQCRC1‐mutant mice (UQ), including those receiving vehicle treatment, exhibited marked reductions in locomotor activity, characterized by sparse and fragmented movement patterns (Figure 2A). In contrast, mice treated with PenArg (UQ‐PA) showed recovery in locomotor behavior, with trajectories resembling WT mice. Quantitative analysis of movement parameters revealed significant and consistent improvements in the UQ‐PA group across all measured metrics (Figure 2B), including total distance moved, velocity, movement duration, and number of zone crossings among the four predefined zones (zone crossing frequency).

TH IHC demonstrated reduced dopaminergic neuron staining in the SN and ST of UQ and UQ‐Sham mice compared with WT controls (Figure 3A,B).

Although non‐motor outcomes were not assessed, DG preservation may be relevant to PD‐associated cognitive and affective dysfunction [28, 29].

Western blot analysis of SN tissue showed increased cleaved caspase‐3 (C‐Casp3) and cytochrome c (Cyt c), together with reduced ATPB expression in mutant groups (Figure 3C,D). The Cyt c/ATPB ratio, used as an index of mitochondrial cytochrome c release relative to mitochondrial content, was elevated in UQ‐Sham mice and reduced following PenArg treatment, which also restored ATPB expression. Mitochondrial complex III (CIII) activity was decreased in mutant mice and significantly recovered in UQ‐PA mice (Figure 3E).

Our findings support a model in which PenArg stabilizes mitochondrial homeostasis and attenuates intrinsic apoptotic signaling, thereby preserving neuronal viability in the context of UQCRC1‐associated mitochondrial dysfunction. Notably, only a small fraction of PenArg localized to mitochondria, as confirmed by both in vitro and in vivo analyses. Partial mitochondrial localization is consistent with reports that guanidinium‐rich CPPs, typically composed of arginine residues, interact electrostatically with cardiolipin‐rich mitochondrial membranes [15, 17, 24, 25].

To assess brain distribution of intranasal PenArg, streptavidin‐biotin IHC was performed 2 h post‐administration. Figure 4 illustrates sagittal brain sections with red labels indicating regions showing PenArg‐positive brown chromogenic staining. Compared with untreated wild‐type (WT) controls, PA‐treated mice exhibited region‐specific distribution patterns, with signals detected in the anterior olfactory bulb, olfactory bulb (OB), cortex, hippocampus (Hp), thalamus, SN, hypothalamus, pons, cerebellar cortex (Cb), and cerebellar midline white matter. Untreated WT animals showed no detectable staining in corresponding regions. Higher‐magnification images (zoom‐in panels) revealed PenArg localization predominantly within neuronal layers, including the glomerular layer of the OB, the granule cell layer of the DG in the Hp, and the Purkinje cell layer of the Cb. The presence of PenArg signals in deep brain regions and brainstem structures supports rapid and effective brain penetration following intranasal administration.

In the present study, brain distribution was assessed only at a single time point, 2 h after intranasal administration; therefore, brain‐to‐plasma ratio, absolute nasal‐to‐brain transfer efficiency, and elimination kinetics were not determined. In addition, a positive control treatment was not included, which limits direct comparison of PenArg efficacy with established mitochondrial protective or neuroprotective agents. Representative olfactory bulb streptavidin‐biotin staining showed no overt structural disruption after three months of chronic intranasal PenArg treatment (Figure S1). However, further nasal histology and systemic toxicity studies are needed to confirm the safety of repeated intranasal PenArg administration. The potential immunogenicity of arginine‐rich CPPs in humans also warrants investigation.

After 6 months of treatment, tibialis anterior (TA) muscle from UQ and UQ‐Sham mice showed reduced fiber size and density compared with WT controls, both of which were significantly improved in UQ‐PA mice (Figure 5A,B). Western blot analysis revealed increased muscle RING‐finger protein 1 (MURF1) and reduced myosin heavy chain (MyHC) expression in mutant groups, indicating muscle atrophy, which were reversed by PenArg treatment (Figure 5C). Analysis of Akt/FoxO signaling showed reduced total Akt and phosphorylated Akt (p‐Akt) in UQ and UQ‐Sham mice, with restoration in UQ‐PA mice, particularly a significant restoration of p‐Akt (Figure 5D). Phosphorylated FoxO1 (p‐FoxO1) was significantly increased in UQ‐PA compared with UQ‐Sham, whereas phosphorylated FoxO3a (p‐FoxO3a) showed no significant differences among groups. Antioxidant analysis demonstrated reduced catalase levels in mutant mice, which were significantly restored by PenArg. SOD2 showed a similar trend without reaching statistical significance (Figure 5E).

Plasma cytokine analysis revealed no significant differences in IFN‐γ or TNF‐α among groups (Figure 6A,B). In contrast, pro‐inflammatory cytokines IL‐1α, IL‐1β, and IL‐6 were significantly elevated in UQ and UQ‐Sham mice compared with WT controls and were reduced following PenArg treatment (Figure 6C–E). CXCL1/KC and MCP‐1/CCL2 were similarly increased in mutant groups and significantly decreased in UQ‐PA mice (Figure 6H,I). IL‐12 (p70) was elevated in mutant mice but was not significantly altered by PenArg (Figure 6G).

To confirm whether PenArg also reduced brain inflammation, Ionized calcium‐binding adapter molecule 1 (Iba‐1) and Glial fibrillary acidic protein (GFAP) immunofluorescence staining was examined in the SN. UQ and UQ‐Sham mice showed significantly increased Iba‐1 and GFAP signals compared to WT mice, indicating microglial and astrocytic activation. PenArg treatment significantly reduced both Iba‐1 and GFAP fluorescence intensity in UQ‐PA mice (Figure 6J,K).

Improvement of locomotor activity in treated UQCRC1‐mutant mice. (A) Representative locomotor trajectories from open field testing were shown for Wild‐type (WT), UQCRC1‐mutant (UQ), vehicle‐treated mutant (UQ‐Sham), and PenArg‐treated mutant (UQ‐PA) mice, with three examples per group. (B) Quantitative analysis of locomotor parameters, including total distance moved (cm), velocity (cm/s), movement duration (s), and zone crossing frequency. All data are presented as mean ± SEM; *p < 0.05, **p < 0.01, ***p < 0.001, n = 6 per group.

Nigrostriatal dopaminergic neuronal restoration, hippocampal structural preservation, and attenuation of mitochondrial dysfunction and apoptotic signaling in UQCRC1‐mutant mice following PenArg treatment. (A) Representative images of tyrosine hydroxylase (TH) immunohistochemistry in the substantia nigra (SN) and striatum (ST), along with Nissl staining in the dentate gyrus (DG) and granule cell layer (DG‐GCL), from Wild‐type (WT), UQCRC1‐mutant (UQ), vehicle‐treated mutant (UQ‐Sham), and PenArg‐treated mutant (UQ‐PA) mice following 6 months of intranasal administration. (B) Staining intensity of TH‐positive neurons in the SN and ST, and Nissl‐stained neurons in the DG‐GCL was quantified. (C) Representative Western blot images of cleaved caspase‐3 (C‐Casp3), cytochrome c (Cyt c), and ATP synthase subunit beta (ATPB) in the SN brain. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as a loading control. (D) Level of C‐Casp3, Cyt c, ATPB and Cyt c/ATPB ratio were quantitated to assess the cell apoptosis and mitochondrial integrity. (E) Mitochondrial complex III (CIII) enzymatic activity in SN neurons was measured using a commercial enzymatic activity assay kit and normalized to total protein content to validate mitochondrial function. (F) Representative sagittal sections of the SN showing double immunohistochemistry with ATPB‐labeled mitochondria (green) and streptavidin‐detected PenArg (brown). In the UQ‐PA group, robust PenArg signals were observed and showed prominent colocalization with ATPB‐positive mitochondrial structures (indicated by arrows). All data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001; n = 3 per group.

PenArg‐mediated modulation of systemic cytokine profiles in UQCRC1‐mutant mice. Plasma levels of inflammatory cytokines were measured using a multiplex immunoassay platform in four groups: Wild‐type (WT), UQCRC1‐mutant (UQ), vehicle‐treated mutant (UQ‐Sham), and PenArg‐treated mutant mice (UQ‐PA), after six months of intranasal administration. Cytokines analyzed included (A) interferon gamma (IFN‐γ), (B) tumor necrosis factor alpha (TNF‐α), (C) interleukin (IL)‐1α, (D) IL‐1β, (E) IL‐6, (F) IL‐10, (G) IL‐12 (p70), (H) chemokine ligand 1 (CXCL1/KC), and (I) monocyte chemoattractant protein‐1 (MCP‐1/CCL2). (J–K) Representative immunofluorescence images and quantitative analysis of Iba‐1 and GFAP expression in the substantia nigra, used as markers of microglial and astrocytic activation, respectively. All data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, n = 5 per group.

PenArg was applied at 0.5–20 μM for 24 h. Cytoprotection was assessed after 24 h PenArg pretreatment followed by 10 μM t‐BH (Sigma‐Aldrich, St. Louis, MO, USA) exposure for 18 h.

Cellular uptake of PenArg and its effects on mitochondrial membrane potential, neuronal morphology, and apoptosis in UQCRC1 knock‐in SH‐SY5Y cells. (A) Confocal microscopy showing intracellular uptake and distribution of 5‐FAM‐labeled PenArg (10 μM, 16 h). Nuclei were counterstained with DAPI. Z‐stack reconstruction and longitudinal views generated from integrated z‐axis line scans confirmed intracellular localization of the peptide. (B) Quantification of mitochondrial membrane potential (MMP) using TMRE fluorescence in wild‐type (WT) and UQCRC1 knock‐in SH‐SY5Y cells (UQ) treated with various doses of PenArg (1, 5, 10, 20 μM) for 24 h. (C) Representative phase‐contrast images showing cell morphology and filopodium formation after 24‐h treatment with 0.5 μM and 1 μM PenArg. Right panel: Quantification of average filopodia length. (D) Quantification of apoptotic cells using 7‐AAD staining after tert‐butyl hydroperoxide (t‐BH) treatment for 16 h in WT and UQ cells, with or without peptide pretreatment. (E) Fold change of MitoSense Red fluorescence intensity indicating MMP under oxidative stress. All data are shown as mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, n = 3 per group.

Although promising, several limitations remain. PenArg showed only partial mitochondrial colocalization, and its intracellular trafficking, pharmacokinetics, and long‐term safety after intranasal delivery require further evaluation. In the present study, brain distribution was assessed only at a single time point, 2 h after intranasal administration; therefore, brain‐to‐plasma ratio, absolute nasal‐to‐brain transfer efficiency, and elimination kinetics were not determined. In addition, a positive control treatment was not included, which limits direct comparison of PenArg efficacy with established mitochondrial protective or neuroprotective agents. Representative olfactory bulb streptavidin‐biotin staining showed no overt structural disruption after three months of chronic intranasal PenArg treatment (Figure S1). However, further nasal histology and systemic toxicity studies are needed to confirm the safety of repeated intranasal PenArg administration. The potential immunogenicity of arginine‐rich CPPs in humans also warrants investigation.

Furthermore, given its effects on mitochondrial stabilization, oxidative stress reduction, and neuroinflammatory attenuation, PenArg may have therapeutic potential in other PD models characterized by mitochondrial dysfunction, oxidative stress, and neuroinflammation; however, further validation is required.

Although promising, several limitations remain. PenArg showed only partial mitochondrial colocalization, and its intracellular trafficking, pharmacokinetics, and long‐term safety after intranasal delivery require further evaluation. In the present study, brain distribution was assessed only at a single time point, 2 h after intranasal administration; therefore, brain‐to‐plasma ratio, absolute nasal‐to‐brain transfer efficiency, and elimination kinetics were not determined. In addition, a positive control treatment was not included, which limits direct comparison of PenArg efficacy with established mitochondrial protective or neuroprotective agents. Representative olfactory bulb streptavidin‐biotin staining showed no overt structural disruption after three months of chronic intranasal PenArg treatment (Figure S1). However, further nasal histology and systemic toxicity studies are needed to confirm the safety of repeated intranasal PenArg administration. The potential immunogenicity of arginine‐rich CPPs in humans also warrants investigation.

In summary, this study demonstrates that intranasal administration of PenArg confers neuroprotection in a UQCRC1‐mutant model of PD by stabilizing mitochondrial homeostasis and attenuating apoptotic and inflammatory signaling. Beyond its role as a delivery vector, PenArg functions as a bioactive modulator of mitochondrial integrity, producing both central and peripheral protective effects. These findings support the therapeutic potential of CPP‐based strategies targeting mitochondrial dysfunction in neurodegenerative disorders.